Американский Научный Журнал ПРОБЫ ДЛЯ МЕТАГЕНОМНОГО СЕКВЕНИРОВАНИЯ, ОТОБРАННЫЕ В ЗАЛАХ ЖИВОПИСИ ДРЕВНЕЙ РУСИ ГОСУДАРСТВЕННОЙ ТРЕТЬЯКОВСКОЙ ГАЛЕРЕИ

Аннотация. В данной статье охарактеризовали набор проб из залов Живописи Древней Руси основного исторического здания Государственной Третьяковской галереи (Лаврушинский пер., 10, Москва), выбранных для последующего метагеномного секвенирования. Также охарактеризовали соответствующие культуры микроорганизмов, полученные ранее высевом аликвот этих проб на стандартные микробиологические среды. Важнейший этап, определяющий саму возможность метагеномного секвенирования для образцов с заведомо низким содержанием биологического материала, связан с их амплификацией. При одинаковых условиях выделения метагеномной ДНК число циклов, требуемых для наработки требуемого количества ПЦР-фрагмента (больше 5 нг), будет отличаться. Это число зависит, в том числе, с количеством биоматериала в исходной пробе. В данной работе для 86-ти проб проанализировали продуктивность амплификации филогенетически-значимых районов рДНК прокариот (V3/V4) и эукариот (ITS2). Определены пробы, для которых одинаково продуктивно амплифицировились оба типа рДНК, а также, образцы с низкой продуктивностью амплификации V3/V4 и/или ITS2 районов. Полученные данные также важны для сопоставления с последующими результатами метагеномного секвенирования. Скачать в формате PDF
8 American Scientific Journal № ( 29 ) / 20 19
ИММУНОЛОГИ Я И МИКРОБИ ОЛОГИЯ

ПРОБЫ ДЛЯ МЕТАГЕНОМН ОГО СЕКВЕНИРОВАНИЯ, ОТОБРАННЫЕ В ЗАЛАХ
ЖИВОПИСИ ДРЕВНЕЙ РУС И ГОСУДАРСТВЕННОЙ ТР ЕТЬЯКОВСКОЙ ГАЛЕРЕИ

Жгун А.А.
ФИЦ Биотехнологии РАН, институт Биоинженерии, г. Москва
Потапов М.П.
Московский Политехнический Университет , г. Москва
Авданина Д.А.
ФИЦ Биотехнологии РАН, институт Биоинженерии, г. Москва
Волков И.А.
Московский физико -технический институт, г. Долгопрудный
Иванов В.В.
Московский физико -технический институт, г. Долгопрудный


SAMPLES FOR METAGENOMIC SEQUENCI NG TAKEN FROM HALLS OF ANCIENT RUS
PAINTINGS , STATE TRETYAKOV GALL ERY

Zhgun A.A.
Research Center of Biotechnology RAS, Moscow, Russia
Potapov M.P
Moscow Polytechnic University, Moscow, Russia
Avdanina D.A.
Research Center of Biotechnology RAS, Moscow, Russi a
Volkov I.A.
Institute of Physics and Technology, Dolgoprudniy , Russia
Ivanov V.V
Institute of Physics and Technology, Dolgoprudniy , Russia

Аннотация. В данной статье охарактеризовали набор проб из за лов Живописи Древней Руси
основного исторического здания Государственной Третьяковской галереи (Лаврушинский пер., 10,
Москва), выбранных для последующего метагеномного секвенирования. Также охара ктеризовали
соответствующие культуры микроорганизмов, получе нные ранее высевом аликвот этих проб на
стандартные микробиологические среды. Важнейший этап, определяющий саму возможность
метагеномного секвенирования для образцов с заведомо низким содержанием биологического материала,
связан с их амплификацией. При оди наковых условиях выделения метагеномной ДНК число циклов,
требуемых для наработки требуемого количества ПЦР -фрагмента (больше 5 нг), будет отличаться. Это
число зависит, в том числе, с количеством биоматериала в исходной пробе. В данной работе для 86 -ти
пр об проанализировали продуктивность амплификации филогенетически -значимых районов рДНК
прокариот ( V3/V4) и эукариот ( ITS 2). Определены пробы, для которых одинаково продуктивно
амплифицировились оба типа рДНК, а также, образцы с низкой продуктивностью амплификации V3/V4
и/или ITS 2 районов. Полученные данные также важны для сопоставления с последующими результатами
метагеномн ого секвенирования.
Abstract. In this article we characterized a set of samp les from Paintings of Ancient Rus Halls in the main
historical building of State Tretyakov Gallery (Lavrushinsky per. 10, Moscow, Russia), selected for subsequent
metagenomic sequ encing. The corresponding cultures of microorganisms, obtained from those sam ples after
inoculation on standard microbiological media, were also characterized. The critical stage, determining the
possibility of metagenomic sequencing for the samples with l ow content of initial biological material, is associated
with their amplifica tion. Under identical conditions for metagenomic DNA isolation, the number of cycles required
to produce required quantity of PCR fragment (more than 5 ng) will differ and correla tes, inter alia, with the
amount of biomaterial in the initial sample. In cur rent work we analyzed 86 samples for the amplification
productivity of phylogenetically significant rDNA regions, prokaryotic V3/V4 and eukaryotic ITS2. Samples with
high PCR prod uctivity for both types of rDNA, as well as samples with low productivity of V3/V4 and/ or ITS2
fragments were determined. The obtained data are also important for coordination with the subsequent results of
metagenomic sequencing.
Ключевые слова: темперна я живопись, биоповреждение, NGS , MISeq , Государственная
Третьяковская галерея , икона «Церковь Воинствующая»
Keywords: tempera painting, biodeterioration, NGS, MISeq, State Tretyakov Gallery, icon “ The Church
Militant”

American Scientific Journal № (2 9) / 2019 9

Введение
В последние годы в многочисленных
исследованиях показан вклад
микробиологического сообщества в разрушени е
произведений живописи, в частности, масляной
живописи на холсте и темперной живописи [1–4]. В
ряде экспериментов продемонстрировано, что
биод еструкция наиболее эффективна в случае
смешанных микробиомов, состоящих из грибов и
бактерий [5] . Проделаны многочисленные работы
по изуче нию микроорганизмов, поражающих как
отдельные краски [6] , картины [7] , фрески [8,9] , так
и целые музеи [10,11] , библиотеки [12] , монаст ыри
[13,14] , настенную живопись обширных объектов
культурного наследия [4,15] . Однако в настоящее
время опубликовано сравнительно мало статей, где
опасные для произведений искусства
микроорганизмы изучали с использованием
технологии NGS [16] . В частности, крайне мало
NGS -исследований для микробиомов музейных
залов с произведениями живописи. С другой
стороны, существуют многочисленные работы с
применением NGS , посвященные, наприм ер,
микробиому кишечн ика [17] . Такие исследования
ведутся с первых лет создания этой технологии
(начало 10 -х годов 21 в). Это об условлено как
клинической необходимостью, так и значительным
числом пациентов, доступностью материал а.
Государственная Третьяковская галерея ( ГТГ )
– ведущий музей России, где собраны
многочисленные объекты культурного наследия, в
том числе, темперной живо писи. Нам
представилась уникальная возможность
исследовать микробиомы экспонатов темперной
живописи 16 -го века, находившихся в
непосредственной близости от видимых глазом
очагов микробиологического п оражения
(возникших в зале 61). Отбор проб провели в зал ах
56, 57 и 61 Живописи Древней Руси основного
исторического здания ГТГ (Лаврушинский пер., 10,
Моск ва), в том числе, с произведений темперной
живописи 16 -го века: иконы «Церковь
Воинствующая» ( ЦВ ), бюста Георгия Победоносца
(ГП ) и иконы «Св. Великомученик а Димитрия
Солунского» ( ДС ) [18] . Все 106 проб были
отобраны с разрешения главного хранителя
музейных ценностей ГТГ. Аликвоты исходных
образцов инокулировали на аг аризованные
микробиологические среды для получения культур
изолятов [18,19] . Всего удалось получить 119
культур (62 к ультуры на среде CD и 57 культур на
среде LB ) [20] . Из имеющихся 225 образцов (1 06
исходных проб и 119 культур) для метагеномного
секвенирования выбрали 86 проб (41 исходных
проб и соответствующие им 45 изолятов: 39 – на
среде CD и 5 – на среде LB ) [20] . На первом этапе
оптимизировали условия для выделения
метагеномной ДНК ( мДНК ), ПЦР -амплификации и
очистки наработанных ПЦР -фрагментов из
реакционной смеси [20] . В данной работе провели
сравнительный анализ числа циклов, требуемых
для амплификации в оптимизированных условиях
различных образцов мДНК для наработки
филогенетически -значимых фрагментов с целью
MISeq секвенирования. Этот этап первичной
амплификации явл яется критическим для
посл едующего получения данных о микробиомах.
Материалы и методы
Отбор проб, культивирование
микроорганизмов и выделение геномной ДНК
проводили, как описано ранее [18 –20] .
Индексирование. Для обозначения проб в
работе использовали введенное ранее
индексирование [20] . Исходным 106 -ти пробам
присвоили индекс в формате STG -SN , где STG –
название места отбора проб ( State Tretyakov
Galery ), S – обозначение, что это исходная проба
(sample ), N – номер отобранной пробы, от 1 до 109
(с пропуском для 39 – 41 проб, не относящих ся к
данной работе). Номера культивируемых изолятов
соответствовали номерам исходн ых проб, из
которых их получили, и имели индексацию STG -N
(для культивируемых изолятов на ср еде CD ) или
STG -LN (для культивируемых изолятов на среде
LB ). Полный перечень исхо дных образцов и
получен ных на их основе смешанных культур
микроорганизмов опубликован ранее [20] .
Проведение ПЦР. Полимеразную цепную
реакцию проводили на амплификаторе Mastercycler
gradient («Эппендорф», Германия) с помощью
наборов KAPA HiFi HotStart ReadyMixPCR Kit
(«Рош », Швейцария) или ScreenMix («Евроген»,
Россия). В качестве матриц использовали
препараты мДНК, выделенные из исходных проб, а
также, полученных из них культур на средах CD
или LB [18,20] . Амплификацию региона V3/V4
прокариот проводили с парой праймеров 341F_BC/
R806_BC или 341F/ R806. Амплификации участков
эукариотической рДНК проводили: для ITS 2 – с
парой праймеров ITS86F_BC/ ITS 4_ BC ; для ITS 1-
5,8 S-ITS 2 – с парой праймеров ITS 1/ITS 4.
Опт имизир ованные условия ПЦР д ля набора KAPA
HiFi HotStart ReadyMixPCR Kit: «хот -старт» – 98°С,
3 мин; 25 – 35 циклов: отжиг – 60°С для пары
341F_BC/ R806_BC или 61°С для пары ITS86F_BC/
ITS 4_BC , 30сек; элонгация – 72°С, 40 сек;
денатурация – 98°С, 30 сек; за тем финальная
эло нгация – 72°С, 8 мин. Оптимизированные
условия ПЦР для ScreenMix : «хот -старт» – 95°С, 3
мин; 25 – 35 циклов реакций амплификации: отжиг
– 54°С для пары 341F_BC/ R806_BC, 55°С для пары
341 F/R806, 55°С для пары ITS86F_BC/ ITS 4_ BC ,
52°С для п ары ITS 1/ITS 4, 30 -40 сек; э лонгация –
72°С, 30 -50 сек; денатурация – 95°С, 30 сек; затем
финальная элонгация – 72°С, 12 мин. Общий объем
ПЦР смеси для всех вариантов реакций составлял
25 мкл.
Последовательности праймеров,
использованные в работе, приведен ы в таблице 1.

10 American Scientific Journal № ( 29 ) / 20 19
Таблица 1
ПРАЙМЕРЫ, ИСПОЛЬЗОВА ННЫЕ В РАБОТЕ
олигонуклеотид последовательность (5 ’→3’) длина, пн источник
341 F_BC TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG CCTACGGG
NGGCWGCAG 50
[21]
R806_ BC GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG GACTACH
VGGGTATCTAATCC 55
ITS86F_BC TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG GTGAATCA
TCGAATCTTTGAA 54 [22]
ITS 4_BC GTCTCGTGGGCTCGGAGATG TGTATAAGAGACAG TCCTCCGC
TTATTGA TATGC 54 [23]
341 F CCTACGGGAGGCAGCAG 17 [24]
R806 GGACTACHVGGGTWTC TAA 19 [25]
ITS 1 TCCGTAGGTGAACCTGCGG 19 [23] ITS 4 TCCTCCGCTTATTGATATGC 20
Примечание: подчеркнуты участки, соответствующие MiSeq адаптерам.

Определение количества ПЦР -фрагмента.
Количество наработанного ПЦР -фрагмента
определяли после электрофореза на приборе SE -1
(«Helicon», Россия) 5 -ти мкл ПЦР -смеси в 1,8%
агарозном геле, с одержащем 0,25 мкг/мл
бромистого этидия, в ТАЕ буфере (40 мМ Tris -Ac
pH 8.0, 1мМ ЭДТА) относительно маркера длин
ДНК 100+ bp DNA Ladder (Евроген, Россия) в
программе GelAnalyzer 2010a, доступной онлайн
http://www.g elanalyzer.com («Lazarsoftware»,
США). Полученное количество пересчитывали на
общий объем ПЦР -смеси и выра жали в условных
единицах: "±" – меньше 5 нг, "+" – 5-10 нг, "++" –
10 -50 нг, "+++" – 10 -200 нг, "++++" – больше 200
нг.
Очистка ПЦР -фрагментов из ре акционной
смеси. Экстракцию амплифицированных
фрагментов после проведения ПЦР проводили с
использованием на бора CleanupMini («Евроген»,
Россия) методом элюции из геля (после вырезания
скальпелем агарозного фрагмента искомой длины,
визуализация при λ = 320 нм ) в соответствии с
рекомендациями фирмы производителя.
Результаты и обсуждение
В нашей работе охарактеризовали набор проб
из залов Живописи Древней Руси основного
исторического здания ГТГ (Лаврушинский пер., 10,
Москва), выбранных для последующего
метаг еномного секвенирования.
Микробиологические пробы отобрали ранее в залах
Живописи Древней Руси (56, 57 и 61) [18] . В
результате оптимизации этапо в выделения и
амплификации для всех 86 проб удалось наработать
ПЦР -фрагменты с праймерами для районов рДНК –
как V3/V4, так и ITS 2 [20] . Праймеры также
содержали навески для последующего
баркодирования с использованием Nextera XT
Index kit (“Illumina, Inc”, США). Однако при этом
ми нимальное число циклов, требуемое для
получения необходимого количества ПЦР -
продукта (больше 5 нг), отличалос ь.
В соответствие с протоколом фирмы
производителя при использовании KAPA HiFi
HotStart ReadyMixPCR Kit для амплификации с
целью NGS секвенирования, рекомендуется
проводить 25 -35 циклов. При этом подчеркивается
необходимость использования как можно
меньше го числа циклов. С увеличением их числа
данные о представленности микроорганизмов в
исходном образце могут искажаться за счет
различной эффективности ПЦР с различных
матриц. В связи с этим в нашей работе на первом
этапе старались получить необходимые ПЦР -
продукты на матрице мДНК за минимальное, в
соответствии с протоколом, число раундов
амплификации (25 циклов). Однако в
оптимизированных нами условиях это удалось
сделать не для всех образцов.

American Scientific Journal № (2 9) / 2019 11

Рисунок 1. Подбор минимального числа циклов для наработки ПЦ Р-фрагментов (для после дующего
секвенирования на платформе Illumina , MISeq ).

Также для проведения второго ПЦР
(баркодирование) требовалась очистка
наработанных ПЦР -фрагментов из реакционной
смеси. Используемые нами праймеры для первого
(исходного) ПЦР им ели навески для
баркодирования (длиной 50 -55 оснований); кроме
того, некоторые основания в праймерах 341F_BC и
R806_BC, используемых для амплификации
фрагмента V3/V4, были частично или полностью
вырождены (Табл. 1). В условиях,
оптимизированных для амплифи каций целевых
ПЦР -продуктов на матрицах мДНК, получали
побочные продукты реакции в области 100 -150 пар
оснований. Эти примесные фрагменты не
удалялись после обработки методом «очистка из
реакционной смеси», набо р CleanupMini. При
использовании аналогичных праймеров без
довесок для баркодирования (нап ример, 341F/R806
или ITS 1/ITS 4) «очистка из реакционной смеси»
приводила к удалению всех примесных продуктов
и полной очистке целевого ПЦР -продукта. Кроме
того, для пары праймеров 341F_BC/ R806_BC (но
не ITS86F_ BC/ ITS4_BC) наблюдали образова ние
конкатемеров более высокой молекулярной ма ссы
по сравнению с целевым продуктом. В связи с этим,
все получаемые ПЦР -фрагменты искомой длины
чистили методом элюции из геля. Поскольку этот
метод ресурсоемкий и сопровождается потерей
части материала, в исходной ПЦР -реакции должно
было находиться, по к райней мере, 5 -10 нг ПЦР -
фрагмента.

12 American Scientific Journal № ( 29 ) / 20 19
Таблица 2
ПРОБЫ ДЛЯ МЕТАГЕНОМН ОГО АНАЛИЗА, ПОЛУЧЕН НЫЕ С ИКОНЫ «ЦЕРКОВЬ
ВОИНСТВУЮЩАЯ»
Исходная проба Культивируемая проба

V3/V4 BC ITS2 BC

V3/V4 BC ITS2 BC
циклов количество циклов количество циклов количество циклов количество
STG -S3 35 +++ 35 + STG -3 25 ++++ 35 ++
STG -S13 25 ++ 35 ++ STG -13 25 ++++ 35 ++
STG -S21 35 +++ 35 + STG -21 25 ++++ 35 ++
STG -S25 25 +++ 35 +
STG -25G 25 ++++ 25 +++
STG -25W * 25 ++++ 25 +
STG -S26 25 ++++ 35 +++ STG -26 25 ++++ 25 ++
STG -S27 35 + 35 ++ STG -27 25 ++++ 25 ++
STG -S28 25 ++++ 35 +++ STG -28 25 ++++ 35 ++
STG -S29 25 ++ 35 +++ STG -L29 35 ++++ 35 +++
STG -S30 35 +++ 35 +++ STG -30 25 ++++ 25 +
Прим ечание: звездочкой отмечена культура, использованная для инокуляции ЛКМ; подчеркнут изолят,
культивируемый на среде LB .

В связи с этим для наработки ПЦР -фрагментов
использовали следующую схему эксперимента
(Рис. 1). На первом этапе интересующие районы
рД НК исходных матриц (мДНК) амплифицировали
в течение 25 -ти циклов. Далее анализировали
количество наработанного материала в 5 мкл ПЦР
смеси (1/5 части материала) после электрофореза в
агарозном геле. Если видели достаточное для
элюции из геля количество ПЦР -фрагмента
ожидаемого размера, его чистили из реакционной
смеси. В случае визуализации его следовых
количеств (меньше 5 нг ), проводили повторную
амплификацию, при этом число циклов
увеличивали до 30 -ти. Это позволило для всех
подобных случаев наработать до статочное (для
последующих манипуляций) количество ПЦР -
фрагментов. Если после 25 -ти циклов ПЦР -продукт
не визуализировался (меньше 1 нг в 5 мкл), число
циклов увеличивали до 35 -ти. Для подавляющего
большинства образцов наработали ПЦР -
фрагменты, затем их чи стили после элюции из геля.
Для исходной пробы STG -S92 не удалось получить
ПЦР -фрагменты, как бактериальной, так и
эукарио тической рДНК за 25 -35 циклов по
протоколу (Рис. 1) с использованием набора KAPA
HiFi HotStart ReadyMixPCR Kit. Однако
применение Scre enMix позволило наработать
необходимое для дальнейших манипуляций
количество ПЦР -фрагментов рДНК бактерий и
эукариот, в об оих случаях – за 25 циклов.
Возможные причины подробно обсуждаются ранее
[20] .
Таким образом, полученные ПЦР -фрагменты
отличались по числу использованных для
амплификации циклов; их количество приведено в
Табл. 2 -6. В Табл. 2 -6 используется введенное ранее
индексирование [20] . Номера и сходных проб ( STG -
SN ) залиты в голубые боксы, номера культур на
среде CD (STG -N) залиты в зеленые боксы, номера
культур на среде LB (STG -LN ) подчеркнуты и
залиты в желтые боксы. На Рис. 2 и 3 приведены
процентные соотношения для числа исходных и
культивируемых проб соответственно, с которых
рДНК амплифицировалось за 25, 30 или 35 цик лов.
При этом амплификация за 25 циклов (для
исходных проб) могла свидетельствовать о
потенциальном риске бактериального или грибного
поражения объекта. 170 ПЦР -фрагме нтов получили
из 85 -ти проб с использованием
сверхвысокоточной ДНК -полимеразы KAPA Taq
Ho tStart DNA. 2 ПЦР -фрагмента получили из
пробы STG -S92 с менее точной Taq ДНК -
полимеразой (набор ScreenMix ).

American Scientific Journal № (2 9) / 2019 13

Таблица 3
ПРОБЫ ДЛЯ МЕТАГЕНОМН ОГО АНАЛИЗА, ВЗЯТЫЕ В НЕПО СРЕДСТВЕННОЙ БЛИЗОСТ И
ОТ ИКОНЫ «ЦЕРКОВЬ ВО ИНСТ ВУЮЩАЯ» (ЦВ ОКР )
Исходная проба Культивируемая проба

V3/V4 BC ITS2 BC

V3/V4 BC ITS2 BC
циклов количество циклов количество циклов количество циклов количество
STG -S4 25 +++ 35 ++++ STG -4 25 ++++ 35 ++++
STG-S23 25 ++ 35 ++++
STG -23B* 25 ++++ 25 ++++
STG -23W 25 ++++ 35 ++++
STG -S32 35 ++++ 35 ++++ STG -32 25 ++++ 35 ++++
STG -S33 25 ++++ 35 ++++ STG -L33 35 ++++ 35 ++++
STG -S36 25 ++++ 25 ++++ STG -36* 25 ++++ 25 ++++
Примечание: звездочками отмечены к ультуры, использованные для инокуляции ЛКМ; подчеркнут изолят,
культивируемый на среде LB .

В наших экспериментах требовалось
максимально достоверно охарактеризовать состав
микробиологического сообщества в тех или иных
пробах, при этом ПЦР -продукт с фрагм ентами
рДНК необходимо было получить за минимальное
число циклов. При увеличении числа циклов
искажается информация об исходном соотношении
микроорганизмов (их геномной ДНК). Поскольку
изучаемые районы рДНК различных организмов
несколько отличаются (собств енно, поэтому их
используют в качестве филогенетических
маркеров), а ПЦР с отличающихся
после довательностей идет с разной
эффективностью, с каждым циклом процентный
состав амплифицированных матриц все больше
отличается от первоначального. При этом
процентн ое соотношение матриц, для которых
эффективность ПЦР несколько ниже, будет
снижаться, а у кот орых эффективность ПЦР
несколько выше – увеличиваться. В результате,
отличие в эффективности ПЦР у исходных матриц
в составе мДНК, даже на доли процентов, в
конечн ом счете, может выразиться в значительном
изменении процентного состава
амплифицированных с н их фрагментов.
Таблица 4
ПРОБЫ ДЛЯ МЕТАГЕНОМН ОГО АНАЛИЗА, ПОЛУЧЕН НЫЕ С БЮСТА ГЕОРГИЯ
ПОБЕДОНОСЦА
Исходная проба Культивируемая проба

V3/V4 BC ITS2 BC

V3/V4 BC ITS2 BC
циклов количество циклов количество циклов количество циклов количество
STG -S44 30 ++++ 30 +++ STG -L44 35 ++++ 35 +++
STG -S47 30 +++ 35 +++ STG -47 25 ++++ 35 +++
STG -S48 35 +++ 35 ++ STG -48 25 ++++ 35 +++
STG -S49 25 +++ 35 +++ STG -L49 35 ++++ 35 ++++
STG -S52 25 ++++ 35 +++
STG -52 G 25 + 25 +++
STG -52 B* 30 +++ 25 ++++
Примечание: звездочкой отмечена культура, использованная для инокуляции ЛКМ; подчеркнуты изоляты,
культивируемые на среде LB .

14 American Scientific Journal № ( 29 ) / 20 19
В этой связи требуется критический анализ
дан ных о метагеномном секвенировании при
сравнен ии образцов, амп лифицированных за 25
циклов, с образцами, амплифицированными за 30 и
35 циклов. В табл. 2 -6, помимо информации о
количестве циклов, потребовавшихся для
амплификации ПЦР -фрагментов с различных про б,
приведены данные об их количестве. Они
выражены в относите льных единицах,
соответствующим различным весовым диапазонам,
в нг. Эта информация также не несет
информативной нагрузки о содержании исходных
мДНК, а лишь иллюстрирует процесс появления
электроф оретически -видимого количества ПЦР -
фрагмента (от 1 -5 нг) за т о или иное число циклов.
Таблица 5
ПРОБЫ ДЛЯ МЕТАГЕНОМН ОГО АНАЛИЗА, ПОЛУЧЕН НЫЕ С ИКОНЫ
«СВ. ВЕЛИКОМУЧЕНИК Д ИМИТРИЙ СОЛУНСКИЙ»
Исходная проба Культивируемая проба

V3/V4 BC ITS2 BC

V3/V4 BC ITS2 BC
циклов количество циклов количество циклов количество циклов количество
STG -S57 35 +++ 35 ++++ STG -57 * 25 +++ 25 ++
STG -S58 25 + 35 +++ STG -58 25 ++++ 35 +++
STG -S60 35 ++++ 35 ++++ STG -60 25 ++++ 35 +++
STG -S61 25 ++ 35 ++++ STG -61 25 ++++ 35 +++
STG -S63 25 + 35 ++++ STG -L63 35 ++++ 35 +++
STG -S65 25 ++++ 35 ++++ STG -65 25 ++++ 35 ++++
STG -S67 25 + 35 +++ STG -L67 35 ++++ 35 ++++
STG -S69 25 ++ 35 ++++ STG -69 25 ++++ 30 ++
Примечание: звездочкой отмечена культура, использованная для инокуля ции ЛКМ; подчеркнуты изоляты,
культивируемые на среде LB .

Для исходных проб, отобранных с темперной
поверхности иконы «Церковь Воинствующая», 5
(из 9 -ти) бактериальных ПЦР -фрагментов
амплифицировали за 25 циклов (Табл. 2, Рис. 2).
Остальные бактериальные и все 9 эукариотических
фрагментов амплифицировали за 35 ци клов. Это
может косвенно свидетельствовать об отсутствии
значительной грибной контаминации этого
экспоната. На иконе также не было видимых следов
микробиологического поражения. Для
культивируемых на среде CD изолятов за 25 циклов
наработали ПЦР -фрагменты д ля 9 -ти (из 10 -ти)
проб с бактериальными праймерами и для 5 -ти (из
10 -ти) проб с эукариотическими праймерами
(STG 25 G, STG 25W, STG 26, STG 27, STG 30). Эти
данные коррелируют с микробиологическими
дан ными и результатами световой микроскопии. В
5-ти пере численн ых выше культурах
предварительно охарактеризовали мицелиальные
грибы. Тот факт, что в этих пробах за 25 циклов
амплифицировали также бактериальную рДНК,
говорит о смешанной природе изолята. LB -изо лят
STG -L29 показал низкую эффективность
амплификации для об оих типов рДНК – 35 циклов.

American Scientific Journal № (2 9) / 2019 15

Таблица 6
ПРОБЫ ДЛЯ МЕТАГЕНОМН ОГО АНАЛИЗА, ПОЛУЧЕН НЫЕ ИЗ ЗАЛОВ 56, 57, 61 ГТГ
Исходная проба Культивируемая проба

V3/V4 BC ITS2 BC

V3/V4 BC ITS2 BC
циклов количество циклов количество циклов количество циклов количество
STG -S74 25 ++++ 25 ± STG -74 30 +++ 35 +++
STG -S80 25 ++++ 35 ++++ STG -80 25 ++ 35 +++
STG -S84 25 ++++ 35 ++++ STG -84 25 ++++ 35 +++
STG -S85 25 ++ 35 ++++ STG -85 35 ++++ 35 +++
STG -S86 35 ++++ 35 ++++ STG -86 * 25 ++++ 25 ++
STG -S91 35 ++ 35 ++++ STG -91 25 ++ 25 ++++
STG -S92 25 ± 25 + STG -92 25 ++ 25 ++++
STG -S93 35 ++++ 35 ++++
STG -
93W * 25 ++++ 25 ++++
STG -93 B* 25 + 25 ++++
STG -S96 25 ++++ 25 ++++ STG -96 * 25 + 25 ++++
STG -S97 25 ++++ 35 +++ STG -97 25 ± 35 ++++
STG -S98 25 ++ 25 ± STG -98 25 ± 35 ++++
STG -S99 25 ++ 25 ± STG -99 25 + 25 ++++
STG -
S103 35 ++ 25 ± STG -103 * 25 + 25 ++++
STG -
S106 35 ++++ 35 +++ STG -106 * 30 ++++ 30 ++++
Примечание: звездочками отмечены культуры, использованные для инокуляции ЛКМ. Курсивом отмечено
число циклов, при наработке ПЦР -фрагментов с использованием набора ScreenMix .

Для исходных проб, отобранных в
непосредственной близости от иконы «Церковь
Воин ствующая», 4 (из 5 -ти) бактериальных ПЦР -
фрагмен та и один эукариотический ( STG -S36)
амплифицировали за 25 циклов (Табл. 3, Рис. 2).
Бактериальный фрагмент с пробы STG -S32 и 4 (из
5-ти) эукариотических фрагмен тов
амплифицировали за 35 циклов. В
непосредстве нной близости от иконы «Церковь
Воинствующая» та кже не было видимых следов
микробиологического поражения. Однако
амплификация за 25 циклов ITS 2-фрагмента пробы
STG -S36 может свидетельствовать о значительной
грибной контаминации. Эта пробу отобрали с
тыльно й поверхности иконы (со стороны доски),
полученный результат может вызывать некоторую
трево гу за сохранность ЦВ и требует мониторинга.
5 (из 6 -ти) прокариотических П ЦР -фрагментов
соответствующих культур амплифицировали за 25
циклов. Для культивируемых на с реде CD изолятов
за 25 циклов наработали ПЦР -фрагменты для 5 -ти
(из 6 -ти) проб с бактериальными праймерами и для
2-х (из 6 -ти) проб с эукариотическими праймерами
(ST G23B, STG 36). Для остальных 4 -х культур
амплификация эукариотической ДНК требовала 35
цикло в.
В STG 23B, STG 36 предварительно
охарактеризовали мицелиальные грибы; эту
культуры также использовали дляинокуляций
лако -красочных поверхностей. Тот факт, что в эт их
пробах за 25 циклов амплифицировали также
бактериальную рДНК, говорит о смешанной
природ е изолятов. LB -изолят STG -L33 показал

16 American Scientific Journal № ( 29 ) / 20 19
низкую эффективность амплификации для обоих
типов рДНК – 35 циклов.
Рисунок 2. Процентное соотношени е исходных проб по числу циклов, необходимых для наработки ПЦР -
фрагментов рДНК прокариот ( V3/V4) или эукариот ( ITS 2). Наработка за 25 циклов свидетельствует о
потенциальном риске бактериального или грибного поражения.

Для исходных п роб, отобранных с бюста
Георгия Победоносца, 2 (из 5 -ти) бактериальных
ПЦР -фрагмента амплифицировали за 25 циклов
(STG -S48, STG -S52), 2 – за 30 циклов и 1 за 35
циклов (Табл. 4, Рис. 2). Для наработки всех ITS 2
фрагментов потребовалось больше 25 -ти циклов:
для STG -S44 – 30 циклов, для остальных образцов
– 35 циклов. Общая картина близка к данным для
иконы «Церковь Воинствующая» (Табл. 2).
Активно амплифицируются только бактериальные
рДНК, но не эукариотические (грибные). На
экспонате бюста Георгия Победонос ца также не
было видимых следов микробиологического
поражения. Для мДНК изолятов: 3 (из 6 -ти)
бактериальных и 2 (из 6 -ти) эукариотических рДНК
амплифицировали за 25 циклов. Бактериальную
пробу STG -S52 B наработали за 30 циклов, все
остальные ПЦР -фрагменты – за 35 циклов. Обе LB
пробы ( STG -L44 и STG -L49) плохо
амплифицировались для обоих пар праймеров –
потребовалось 35 циклов. Эукариотически е рДНК
наиболее продуктивно наработали с STG -52 G и
STG -52 B, что соотносится с нашими предыдущими
экспериментами с культурами этих грибов. Данные
амплификации с бактериальной парой праймеров
(25 и 30 циклов, соответственно) свидетельствует,
что эти культуры – смешанные.

American Scientific Journal № (2 9) / 2019 17

Рисунок 3. Процентное соотношение культивируемых проб по числу циклов, необходимых для наработки
ПЦР -фрагментов рДНК прокариот ( V3/V4) или эукариот ( ITS 2).

Для исходных проб, отобранных с иконы «Св.
Великомученик Димитрий Солунский», 6 (из 8 -ти)
бактер иальных ПЦР -фрагментов
амплифицировали за 25 циклов (Табл. 5, Рис. 2).
Остальные бактериальные и все 8 эукариотических
фрагментов амплифицировали за 35 циклов. Это
может косвенно свидетельствовать об отсутствие
значительной грибной контам инации этого
экспо ната. Как и для предыдущих объектов (ЦВ,
ГП) на иконе «Св. Великомученик Димитрий
Солунский» также не было видимых следов
микробиологического поражения. Для мДНК
культур ДС: 6 (из 8 -ми) бактериальных и 1 (из 8 -ми)
эукариотических ПЦР -фраг ментов получили за 25
циклов; один ПЦР -фрагмент с ITS 2 (для пробы
STG -69) получили за 30 циклов; для амплификации
остальных ПЦР -фрагментов потребовалось 35
циклов. STG -L63 и STG -L67 также, как и все другие
анализируемые LB -культуры ( STG -L29, STG -L33,
STG -L44, STGL -49) плохо амплифицировались с
обоих пар праймеров, требовалось 35 циклов. Такие
данные неожиданны, поскольку для получения
мДНК из культуры изолятов не было никаких
ограничений по количеству исходного материала, а
матрицы с LB -культур демонстриров али
ампл ификацию, значительно худшую, чем даже
матрицы, выделенные из невидимых количеств
исходных проб с икон. Подавляющее большинство
мДНК из CD -культур амплифицировалось за 25
циклов с бактериальными и/ или
экукариотическими рДНК праймерами. Тот факт,
что микро биологическая культура не
амплифицируется за 25 циклов ни с
прокариотическими, ни с эукариотическими
праймерами вызывает вопрос. В любом случае,
информация о метагеномном секвенировании всех
проб (полученных как за 25, так и за 30 -35 циклов),
позво лит окон чательно интерпретировать
полученные результаты. В настоящей работе
можем лишь критически оценить важные, но
промежуточные, результаты эксперимента. Для
эукариотической пары праймеров за 25 циклов
ожидаемо амплифицировался образец STG -57,
используе мый такж е для экспериментов по
грибному заражению макетов с лакокрасочными
материалами [18] . Эффективная амплификация
прокариотической рДНК с этой пробы также
указывает на то, что культура смешанная.

18 American Scientific Journal № ( 29 ) / 20 19
Рисунок 4. Основные этапы расшифровки состава микробиома в пробе с использованием технологии
NGS на платформе Illum ina , MISeq .

Наконец, для исходных проб, отобранных в
залах ГТГ, в основном, с очагов
микробиологического поражения (зал 61),
наблюдали совершено другую картину, чем для
проб с экспонатов. 9 (из 14 -ти) прокариотически х и
6 (из 14) эукариотических ПЦР -фраг ментов
наработали за 25 циклов (Табл. 6, Рис. 2).
Отличительная особенность – наличие
значительного количества наработанных за 25
циклов эукариотических ПЦР -фрагментов на
матрицах мДНК. Эти данные коррелируют с
визуаль ным наблюдением – пробы отбирались с
видимых очагов микробиологического (в
особенности, грибного) поражения стен, потолков,

American Scientific Journal № (2 9) / 2019 19

трещин, подоконников. Все пробы, с которых
амплифицируются бактериальные и/ или
эукариотические рДНК фрагменты за 25 циклов,
отобрал и в зале 61. Проба STG -S103 дала ITS 2
фрагмент и была отобрана с подоконника зала 56.
Проба STG -S106 амплифицировалась с обоими
типами праймеров только за 35 циклов. Для 12 (из
15 -ти) полученных на основе этих проб культур за
25 циклов наработали бактериал ьные ПЦР -
фрагменты, для 8 (из 15 -ти) – эукариотические. 2
пробы дали бактери альный ПЦР фрагмент за 30
циклов, одна ( STG -85) – дала бактериальный
фрагмент за 35 циклов. В 6 -ти культурах ( STG -74,
STG -80, STG -84, STG -85, STG -97, STG -98)
эукариотический фрагмент нарабатывался лишь за
35 циклов, чт о может свидетельствовать о наличии
преимущественно бактерий в ку льтуре. Однако с
образца STG -85 также плохо наработалась
бактериальная ДНК. Это необходимо уточнить при
интерпретации данных MISeq . Среди культур,
наработанных за 25 циклов, ПЦР -фрагмент с ITS2
ожидаемо амплифицировали для STG -86, STG -92,
STG -93 W, STG -93 B, STG -96, STG -103. Их
использовали ранее для заражения макетных слоев,
методами световой микроскопии
идентифицировали мицелиаль ные грибы [18] . Все
эти пробы также давали за 25 циклов фрагмен т
V3/V4, что говорит об их смешанной природе. Для
используемого в экспериментах по инокуляции
изолята STG 106, бактериальные и эукариотические
рДНК фрагменты наработали только за 30 циклов.
При этом их количество было значительным, более
200 нг в ПЦР -смеси. Поэтому использование 30 -ти,
а не 25 -ти циклов, возможно, связан о с
методической ошибкой (которую нужно будет
учитывать при анали зе данных MISeq ), но не с
характеристикой самого изолята.
Общая стратегия получения материала (ПЦР -
фрагментов с филогенетическ и-значимыми
участками рДНК бактерий и эукариот) для
метагеномного секвенирования на платформе
Illumina , MISeq и расшифровки состава
микробиома в пробе приведена на Рис. 4.
Заключение
В результате можно сделать вывод, что данные
о числе циклов, необходимых для наработки ПЦР -
фрагментов с рДНК прокариот или эукариот из
мД НК изучаемых проб коррелируют с
предыдущими экспериментами. Для и сходных
проб с экспонатов темперной живописи за 25
циклов удалось амплифицировать только
бактериальные (примерно для половины образцов),
но не грибные рДНК. На всех экспонатах не было
видно с ледов биопоражения. Для проб, отобранных
из очагов микробиологиче ского поражения, в
непосредственной близости от изучаемых
экспонатов, за 25 циклов амплифицировались 65%
бактериальных (9 из 1 4-ти проб) и 43% грибных
рДНК (6 из 14 -ти проб). Для мДНК из всех культур
(использованных в предыдущих работах для
инокуляции маке тов с лакокрасочными
материалами) эффективно амплифицировали
фрагменты ITS 2 и V3/V4. Проведенное в этой
работе изучение данных амплификаций мДНК
крайне важно для реализации конечной цели
рабо ты - интерпретации данных MISeq и
филогенетического анализа исследуемого
микробиома ГТГ.
Авторы выражают благодарность главному
хранителю музейных предметов Государственной
Третьяковской галереи Татьяне Семеновне
Городковой за предоставленную возможность
работать с материалом галереи, старшему
научному сотруднику Государственной
Третьяковской галереи Елене Алекс андровне
Любавской за квалифицированну ю помощь при
работе с произведениями искусства.
Работа поддержана грантом РФФИ 17 -29 -
04349.

Список использо ванной литерату ры
1. López -Miras M, Piñar G, Romero -Noguera J,
Bol ívar -Galiano FC , Ettenauer J, Sterflinger K, et al.
Microbial communities adhering to the obverse and
reverse sides of an oil painting on canv as: identification
and evaluation of their biodegradative potential.
Aerobiologia (Bologna). 2013;29: 301 –314.
doi:10.1007/s10453 -012 -9281 -z
2. Sterflinger K, Piñar G. Microbial deterioration
of cultural heritage and works of art --tilting at
windmills? Ap pl Microbiol Biotechnol. 2013;97:
9637 –46. doi:10.1007/s00253 -013 -5283 -1
3. Poyatos F, Morales F, Nicholson AW,
Giordano A. Physiology of biode terioration on canvas
paintings. J Cell Physiol. 2018;233: 2741 –2751.
doi:10.1002/jcp.26088
4. Rosado T, Silva M, Dias L, Candeias A, Gil
M, Mirão J, et al. Microorganisms and the integrated
conservation -intervention process of the renaissance
mural paint ings from Casas Pintadas in Évora – Know
to act, act to preserve. J King Saud Univ - Sci. 2017;29:
478 –486. doi: 10.1016/j.jksus.2017.09.001
5. López -Miras M del M, Martín -Sánchez I,
Yebra -Rodríguez Á, Romero -Noguera J, Bolívar -
Galiano F, Ettenauer J, et a l. Contribution of the
Microbial Communities Detected on an Oil Painting on
Canvas to Its Biodeterioration. Chat urvedi V, editor.
PLoS One. 2013;8: e80198.
doi:10.1371/journal.pone.0080198
6. Scott DA, Warmlander S, Mazurek J, Quirke
S. Examination of som e pigments, grounds and media
from Egyptian cartonnage fragments in the Petrie
Museum, University College London . J Archaeol Sci.
2009;36: 923 –932. doi:10.1016/J.JAS.2008.12.011
7. Santos A, Cerrada A, García S, San Andrés M,
Abrusci C, Marquina D. Applic ation of Molecular
Techniques to the Elucidation of the Microbial
Community Structure of Antique Paintings. Micr ob
Ecol. 2009;58: 692 –702. doi:10.1007/s00248 -009 -
9564 -2
8. Rosado T, Gil M, Mirão J, Candeias A,
Caldeira AT. Oxalate biofilm formation in mur al
paintings due to microorganisms – A comprehensive
study. Int Biodeterior Biodegradation. 2013;85: 1 –7.
doi:10 .1016/J.IBIOD.2013.06.013
9. Milanesi C, Baldi F, Vignani R, Ciampolini F,

20 American Scientific Journal № ( 29 ) / 20 19
Faleri C, Cresti M. Fungal deterioration of medieval
wall fresco det ermined by analysing small fragments
containing copper. Int Biodeterior Biodegradation.
2006;57: 7 –13. doi:10.10 16/J.IBIOD.2005.10.002
10. Paiva de Carvalho H, Mesquita N, Trovão J,
Fernández Rodríguez S, Pinheiro AC, Gomes V, et al.
Fungal contamination of paintings and wooden
sculptures inside the storage room of a museum: Are
current norms and reference values a dequate? J Cult
Herit. 2018;34: 268 –276.
doi:10.1016/J.CULHER.2018.05.001
11. Kaarakainen P, Rintala H, Vepsäläinen A,
Hyvärinen A, Nevalainen A, Meklin T. Microbial
content of house dust samples determined with qPCR.
Sci Total Environ. 2009;407: 4673 –468 0.
doi:10.1016/J.SCITOTENV.2009.04.046
12. Micheluz A, Manente S, Tigini V, Prigione V,
Pinzari F, Ravagnan G, et al. The extreme environment
of a library: Xerophilic fungi inhabiting indoor niches.
Int Biodeterior Biodegradation. 2015;99: 1 –7.
doi:10.101 6/J.IBIOD.2014.12.012
13. Rubio RF, Bolívar FC. Preliminary study on
the biodeterioration of canvas paintings from the
seventeenth century by m icrochiroptera. Int Biodeterior
Biodegradation. 1997;40: 161 –169.
doi:10.1016/S0964 -8305(97)00043 -7
14. Cennamo P, Montuori N, Trojsi G, Fatigati G,
Moretti A. Biofilms in churches built in grottoes. Sci
Total Environ. 2016;543: 727 –738.
doi:10.1016/j.sci totenv.2015.11.048
15. Veneranda M, Prieto -Taboada N, de
Vallejuelo SF -O, Maguregui M, Morillas H, Marcaida
I, et al. Biodeterioration of Pompeian mural paintings:
fungal colonization favoured by the presence of
volcanic material residues. Environ Sci Pol lut Res.
2017;24: 19599 –19608. doi:10.1007/s11356 -017 -
9570 -8
16. Ogawa A, Celikkol -Aydin S, Gaylarde C,
Baptist a-Neto JA, Beech I. Microbiomes of Biofilms
on Decorative Siliceous Stone: Drawbacks and
Advantages of Next Generation Sequencing. Curr
Microbio l. 2017;74: 848 –853. doi:10.1007/s00284 -
017 -1257 -3
17. Panek M, Čipčić Paljetak H, Barešić A, Perić
M, Matijaši ć M, Lojkić I, et al. Methodology
challenges in studying human gut microbiota – effects
of collection, storage, DNA extraction and next
generati on sequencing technologies. Sci Rep. 2018;8:
5143. doi:10.1038/s41598 -018 -23296 -4
18. Zhgun AA, Avdanina DA, Si monenko NP,
Volkov IA, Ivanov VV. Detection of biodeterioration
on materials used in tempera painting. Znan misel J.
2018;1: 7 –15.
19. Zhgun A A, Avdanina DA, Potapov MP,
Stepanov MG, Shitov M V. Genotyping of
microorganisms capable of damaging materials used in
tempera painting. Znan misel J. 2018;20: 6 –13.
20. Zhgun AA, Potapov MP, Avdanina DA.
Optimization of preparation stages for metagenom ic
sequencing of samples taken from XVI century
tempera painting in State Tretyakov Gallery.
Сolloquium -journal. 2019;17 (41): 4 –12.
21. Klindworth A, Pruesse E, Schweer T, Peplies
J, Quast C, Horn M, et al. Evaluation of general 16S
ribosomal RNA gene P CR primers for classical and
next -generation sequencing -based diversity studies.
Nucleic Acid s Res. 2013;41: e1 –e1.
doi:10.1093/nar/gks808
22. Turenne CY, Sanche SE, Hoban DJ,
Karlowsky JA, Kabani AM. Rapid identification of
fungi by using the ITS2 geneti c region and an
automated fluorescent capillary electrophoresis system.
J Clin Microbiol. 199 9;37: 1846 –51. Available:
http://www.ncbi.nlm.nih.gov/pubmed/10325335
23. White TJ, Bruns T, Lee S, Taylor J.
Amplification and Direct Sequencing of Fungal
Riboso mal RNA Genes for Phylogenetics. PCR
Protocols. Elsevier; 1990. pp. 315 –322.
doi:10.1016/B978 -0-12 -372180 -8.50042 -1
24. Caporaso JG, Lauber CL, Walters WA, Berg -
Lyons D, Lozupone CA, Turnbaugh PJ, et al. Global
patterns of 16S rRNA diversity at a depth of millions of
sequences per sample. Proc Natl Acad Sci U S A.
2011;108 Suppl 1: 4516 –22.
doi:1 0.1073/pnas.1000080107
25. Edwards U, Rogall T, Blöcker H, Emde M,
Böttger EC. Isolation and direct complete nucleotide
determination of entire genes. Cha racterization of a
gene coding for 16S ribosomal RNA. Nucleic Acids
Res. 1989;17: 7843 –53. Available:
http://www.ncbi.nlm.nih.gov/pubmed/2798131